@inproceedings{395ba366036340209749a92aad1246d7,
title = "The effect of inter-strand hopping term on charge transport properties of an aperiodic DNA molecule",
abstract = "The effect of inter-strand hopping on charge transport process in an aperiodic DNA molecule has been studied using a tight-binding Hamiltonian model. In this study, a double stranded aperiodic DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA in one strand and its complement strand is used. The molecule is connected to an electrode on both ends. In the model, inter-base electron hopping is taken into account and represented by the inter-strand hopping parameter. The charge transport properties are studied from calculating transmission probability and I-V characteristics. Transfer matrix and scattering matrix methods are simultaneously used in computing transmission probability. The transmission probability is used in calculating the I-V characteristics using Launder-B{\"u}ttiker formula. The result shows that change in inter-strand hopping term changes transmission probability, which changes I-V characteristics. The effect is clearer at high voltage and high temperature.",
keywords = "Aperiodic DNA Molecule, I-V characteristic, Inter-strand, transmission probability",
author = "R. Rahman and E. Yudiarsah",
note = "Publisher Copyright: {\textcopyright} 2017 Author(s).; 2nd International Symposium on Current Progress in Mathematics and Sciences 2016, ISCPMS 2016 ; Conference date: 01-11-2016 Through 02-11-2016",
year = "2017",
month = jul,
day = "10",
doi = "10.1063/1.4991137",
language = "English",
series = "AIP Conference Proceedings",
publisher = "American Institute of Physics Inc.",
editor = "Sugeng, {Kiki Ariyanti} and Djoko Triyono and Terry Mart",
booktitle = "International Symposium on Current Progress in Mathematics and Sciences 2016, ISCPMS 2016",
}