The effect of inter-strand hopping term on charge transport properties of an aperiodic DNA molecule

R. Rahman, Efta Yudiarsah

Research output: Chapter in Book/Report/Conference proceedingConference contributionpeer-review

Abstract

The effect of inter-strand hopping on charge transport process in an aperiodic DNA molecule has been studied using a tight-binding Hamiltonian model. In this study, a double stranded aperiodic DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA in one strand and its complement strand is used. The molecule is connected to an electrode on both ends. In the model, inter-base electron hopping is taken into account and represented by the inter-strand hopping parameter. The charge transport properties are studied from calculating transmission probability and I-V characteristics. Transfer matrix and scattering matrix methods are simultaneously used in computing transmission probability. The transmission probability is used in calculating the I-V characteristics using Launder-Büttiker formula. The result shows that change in inter-strand hopping term changes transmission probability, which changes I-V characteristics. The effect is clearer at high voltage and high temperature.

Original languageEnglish
Title of host publicationInternational Symposium on Current Progress in Mathematics and Sciences 2016, ISCPMS 2016
Subtitle of host publicationProceedings of the 2nd International Symposium on Current Progress in Mathematics and Sciences 2016
EditorsKiki Ariyanti Sugeng, Djoko Triyono, Terry Mart
PublisherAmerican Institute of Physics Inc.
ISBN (Electronic)9780735415362
DOIs
Publication statusPublished - 10 Jul 2017
Event2nd International Symposium on Current Progress in Mathematics and Sciences 2016, ISCPMS 2016 - Depok, Jawa Barat, Indonesia
Duration: 1 Nov 20162 Nov 2016

Publication series

NameAIP Conference Proceedings
Volume1862
ISSN (Print)0094-243X
ISSN (Electronic)1551-7616

Conference

Conference2nd International Symposium on Current Progress in Mathematics and Sciences 2016, ISCPMS 2016
CountryIndonesia
CityDepok, Jawa Barat
Period1/11/162/11/16

Keywords

  • Aperiodic DNA Molecule
  • I-V characteristic
  • Inter-strand
  • transmission probability

Fingerprint Dive into the research topics of 'The effect of inter-strand hopping term on charge transport properties of an aperiodic DNA molecule'. Together they form a unique fingerprint.

Cite this