Skip to main navigation Skip to search Skip to main content

Penentuan Konsentrasi Minimal Gen B1 dan Gen p30 Toxoplasma Gondii yang Masih Terdeteksi dengan Reaksi Rantai Polimerase

Research output: Contribution to journalArticlepeer-review

Abstract

Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. A serological test (ELISA) for detecting the presence of IgG and IgM antibodies against T.gondii is usually performed nowadays, however this serological test is not adequate. Therefore an accurate laboratory test is needed for diagnosing acute toxoplasmosis, and in this case the polymerase chain reaction (PCR) is the method of choice. The aim of this study is to assess the minimal concentration of the DNA of T.gondii which still can be detected by the PCR using B1 and P30 genes as targets. The PCR against B1 gene as target was performed by using the method described by Chang & Ho. Two methods described by Weiss et al and Chang & Ho were used against P30 gene as target. The B1 gene primers consisted of oligo 1 :5’GGAACTGCATCCGTTCAGA G3’ and oligo 2 : 5’TCTTTAAAGCGTTCGTGGTC3’, whereas the P30 gene primers consisted of oligo 1 : 5’CACACGGTTGTATGTCGGTTTCG CT3’ and oligo 2 : 5’TCAAGG AGCTCAAT GTTACAGCCT3’. It was shown that no specific bands were observed in the PCR with P30 gene as target using the method by Weiss et al. With the method Chang & Ho the electrophoresis did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. It was concluded that the assay using B1 gene as target was more sensitive than the one using P30 gene as target.
Original languageIndonesian
JournalMakara Journal of Health Research
Volume6
Issue number2
DOIs
Publication statusPublished - Dec 2002

Cite this