Internal twisting motion dependent conductance of an aperiodic DNA molecule

Vandan Wiliyanti, Efta Yudiarsah

Research output: Chapter in Book/Report/Conference proceedingConference contributionpeer-review

8 Citations (Scopus)

Abstract

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from a base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer-Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.

Original languageEnglish
Title of host publicationInternational Symposium on Current Progress in Mathematics and Sciences 2015, ISCPMS 2015
Subtitle of host publicationProceedings of the 1st International Symposium on Current Progress in Mathematics and Sciences
EditorsTerry Mart, Djoko Triyono
PublisherAmerican Institute of Physics Inc.
ISBN (Electronic)9780735413764
DOIs
Publication statusPublished - 19 Apr 2016
Event1st International Symposium on Current Progress in Mathematics and Sciences, ISCPMS 2015 - Depok, Indonesia
Duration: 3 Nov 20154 Nov 2015

Publication series

NameAIP Conference Proceedings
Volume1729
ISSN (Print)0094-243X
ISSN (Electronic)1551-7616

Conference

Conference1st International Symposium on Current Progress in Mathematics and Sciences, ISCPMS 2015
Country/TerritoryIndonesia
CityDepok
Period3/11/154/11/15

Fingerprint

Dive into the research topics of 'Internal twisting motion dependent conductance of an aperiodic DNA molecule'. Together they form a unique fingerprint.

Cite this