@inproceedings{6285fe8c72c249b88f55bdd9116d8d9f,
title = "Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair",
abstract = "The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer B{\"u}ttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.",
author = "Sinurat, {E. N.} and E. Yudiarsah",
note = "Publisher Copyright: {\textcopyright} 2017 Author(s).; 2nd International Symposium on Current Progress in Mathematics and Sciences 2016, ISCPMS 2016 ; Conference date: 01-11-2016 Through 02-11-2016",
year = "2017",
month = jul,
day = "10",
doi = "10.1063/1.4991142",
language = "English",
series = "AIP Conference Proceedings",
publisher = "American Institute of Physics Inc.",
editor = "Sugeng, {Kiki Ariyanti} and Djoko Triyono and Terry Mart",
booktitle = "International Symposium on Current Progress in Mathematics and Sciences 2016, ISCPMS 2016",
address = "United States",
}