Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

E. N. Sinurat, Efta Yudiarsah

Research output: Chapter in Book/Report/Conference proceedingConference contributionpeer-review

1 Citation (Scopus)

Abstract

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Original languageEnglish
Title of host publicationInternational Symposium on Current Progress in Mathematics and Sciences 2016, ISCPMS 2016
Subtitle of host publicationProceedings of the 2nd International Symposium on Current Progress in Mathematics and Sciences 2016
EditorsKiki Ariyanti Sugeng, Djoko Triyono, Terry Mart
PublisherAmerican Institute of Physics Inc.
ISBN (Electronic)9780735415362
DOIs
Publication statusPublished - 10 Jul 2017
Event2nd International Symposium on Current Progress in Mathematics and Sciences 2016, ISCPMS 2016 - Depok, Jawa Barat, Indonesia
Duration: 1 Nov 20162 Nov 2016

Publication series

NameAIP Conference Proceedings
Volume1862
ISSN (Print)0094-243X
ISSN (Electronic)1551-7616

Conference

Conference2nd International Symposium on Current Progress in Mathematics and Sciences 2016, ISCPMS 2016
CountryIndonesia
CityDepok, Jawa Barat
Period1/11/162/11/16

Fingerprint Dive into the research topics of 'Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair'. Together they form a unique fingerprint.

Cite this